You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below:
Primer-F: CGTTTCCCGCCTTCAGTTTAGC
Primer-R: CCCGATCTAGTAACATAGATGACACC
a.) Based on protocol we used in class for DreamTaq DNA polymerase design PCR cycling program for amplification of this fragment.
PCR cycling program:
Put the tubes into the thermocycler programmed as follows:
95°C initial denaturation, 2 min (1 cycle)
35 cycles of:
95°C denaturation, 30 seconds
54°C annealing, 30 seconds
72°C extension, 1 min
Final extension:
72°C extension for 5 min (1 cycle)
4°C cool down