BTEC 3301 Lecture Notes - Lecture 3: Open Reading Frame, Start Codon, Reading Frame
4 May 2018
School
Department
Course
Professor
BTEC 3301
Basic Molecular Biology
1. The DNA sequence below was used as a template for producing RNA,
3' GGTATATCCGGGAAATTC 5' (coding strand)
mRNA ’ CCAUAUAGGCCCUUUAAG 3’ (anticoding strand)
Below the DNA, type the mRNA sequence that will be transcribed and appropriately label the two ends as
5' or 3'. If the DNA sequence above was used as a template for producing RNA, would it be the coding
strand or anticoding strand? Also, write down the tRNA sequence, complementary to each mRNA codons.
antiding strand
tRNA 3’ GGUAUAUCCGGGAAAUUC ’
2. How many amino acids are encoded by the following portion of mRNA sequence (do not count start and
stop codons, if any). Is there an in-frame stop codon? _4 amino acids, 1 stop codon, UGA__
RNA ’ CAUCCACUUGGUUGA 3’
3. Consider the following sequence of genomic DNA which is a template strand containing the beginning of
the open reading frame for a gene:
3' TAAACTGTACAGGGCCATAACT 5'
5’ ATTTGACATGTCCCGGTATTGA 3’ transcribed open reading frame.
mRNA 5’ AUUUGACAUGUCCCGGUAUUGA 3’
(a) Find the open reading frame and identify the start codon by circling it. (highlighted)
(b) Transcribe the open reading frame into a strand of mRNA. Lael the ’ ad 3’ eds of the RNA.
Identify the start codon by highlighting it green.
(c) What is the amino acid sequence of the peptide encoded by this strand of mRNA?
Start-Ser-Arg-Try-Stop
4. Given the following diagram of a typical eukaryotic coding gene, draw a basic sketch showing gene
transcription and processing into a mature mRNA. Hint: You should draw two steps, and the final step
should identify what parts of the information in the gene’s DNA reais i the RNA. You can use
Powerpoint or Paint to process the pre-mRNA.
Transcription
find more resources at oneclass.com
find more resources at oneclass.com
Document Summary
3" mrna (cid:1009)": the dna sequence below was used as a template for producing rna, Below the dna, type the mrna sequence that will be transcribed and appropriately label the two ends as. Also, write down the trna sequence, complementary to each mrna codons. antiding strand trna 3". Gguauauccgggaaauuc (cid:1009)": how many amino acids are encoded by the following portion of mrna sequence (do not count start and (cid:373)rna (cid:1009)" cauccacuugguuga 3" stop codons, if any). _4 amino acids, 1 stop codon, uga_: consider the following sequence of genomic dna which is a template strand containing the beginning of the open reading frame for a gene: 3" transcribed open reading frame. (a) find the open reading frame and identify the start codon by circling it. (highlighted) (b) transcribe the open reading frame into a strand of mrna. La(cid:271)el the (cid:1009)" a(cid:374)d 3" e(cid:374)ds of the (cid:373)rna.
