BIL 150 Lecture Notes - Lecture 25: Transposable Element, Noncoding Dna, Stomach Cancer

29 views4 pages

erinalligator886

28 Nov 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Comparisons of genomes among organisms provide information about the evolutionary history of genes and organisms. Genomics: the study of whole sets of genes and their interactions. Bioinformatics: the application of computational methods to the storage and analysis of biological data; emerging field of biology. Cloning the dna is a plasmid or bacteria. Powerful computer programs are used to order fragments into a continuous sequence. Understanding genes and their products at the systems level. Proteomics is the systematic study of all proteins encoded by a genome and their interactions. A systems biology approach has medical applications. Treatment of cancers and other diseases can be individually tailored following the analysis of gene expression patterns. Genomes vary in size, number of genes and gene density. Currently, the sequencing of over 5,500 genomes is happening. No direct relationship between complexity and the number of genes. A mustard plant has 26,000 genes, but a human only has 25,000 genes, even though it is more complex.

Related Questions

I just need someone to interpret exactually what I'm suppose todo here. I understand how to compare the sequecnces, however Idon't know exactually how to put them in order. also I can't findout how to find the what chromosome the sequence came from. So farall I gather to do from this is to find which segments overlap, addthe length, tell how big the chromesomeContigs and ShotgunSequencing
In this chapter, we discussed how wholeâgenome shotgun sequencingmethods can be used to assemble chromosome maps. Recall that in thetechnique of shotgun cloning, chromosomal DNA is first digestedwith different restriction enzymes to create a series ofoverlapping DNA fragments called contiguous sequences, or"contigs." The contigs are then subjected to DNA sequencing, afterwhich bioinformaticsâbased programs are used to arrange the contigsin their correct order on the basis of short overlapping sequencesof nucleotides.

In this Exploring Genomics exercise, you will carry out asimulation of contig alignment to help you understand theunderlying logic of this approach to creating sequence maps of achromosome. For this purpose, you will return to the NationalCenter for Biotechnology Information BLAST site that was used inother Exploring Genomics exercises and apply a DNA alignmentprogram called bl2seq.

Exercise I: Arranging Contigs to Create a Chromosome Map
1. Access BLAST from the NCBI Web site athttp://www.ncbi.nlm.nih.gov/BLAST/. Locate and select the "Aligntwo sequences using BLAST (bl2seq)" category at the bottom of theBLAST home page. The bl2seq feature allows you to compare two DNAsequences at a time to check for sequence similarityalignments.

2. Below are eight contig sequences taken from an actual humanchromosome sequence deposited in GenBank. For this exercise we haveused short fragments; however, in reality contigs are usuallyseveral thousand base pairs long. To complete this exercise, copyand paste two sequences into the Align feature of BLAST and thenrun an alignment (by clicking on "Align"). (Hint: Access thesesequences from the Companion Web site so that you can copy andpaste the sequences easily.) Repeat these steps with othercombinations of two sequences to determine which sequences overlap,and then use your findings to create a sequence map that placesoverlapping contigs in their proper order. A few tips toconsider:

â¢Develop a strategy to be sure that you analyze alignments for allpairs of contigs.
â¢Only consider alignment overlaps that show 100 percent sequencesimilarity.
Sequence A
CTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGAT
TACAAGCATGAGCCACCACTCCCAGGCTTTATTTTCTATTTTTTAATTACAGCCATCCTAGTGAATGTGAAGTAGTATCTCACTGAGGTTTTGATTTGCATTTTTCTATGACA
ATGAACAATGTTTCATGTGCTTGTTGGCTGTTTGTATATCCTTTTTGGAGAAATACCAATTCATGTCCTTTGCCCATTTTTAAAGTGGATTGCATGTCTTTTTGTTGTTTAGT
TGTAAAGATGTGGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCT
CCTGCCTCAGCCTTCCAAGTAGCTGGGTTTACAGATGC

Sequence B
CTTTATCTCAGGACAATGAACCCGCAAGGAGAGGAAGAGCCAGTAATTCTATAGAGACTCGGAGGCGCAGGGGGCACGCTTAGTTAGAGTGGTGGTGGTATTTTCAGTGTTTT
CTGGTTTTATGATAAACACAAGCATCAATGTCTCAAGACTTTCATCTTTATCTTTTTTTTTTTTTTTTTTTTTTTCTTGAGACAGGGTTTCCCTCTGTCACCCAGGCTGGAGT
GCATTGGTGGTGTGATCTTGGCTTTCTGTAACCTCGGGCTTCTGGGCTCAAGCCGTTCTACTACCTCAGCCTCCCAAATAGCTAGAACTACAAGCGTGTGCTGCCACACCTGG
CTAATTTGTTGTATTTTATTTATTCATTTATTTTTGTGAAGACAAGGTCTTGCCATGTTGCCCAGGCTGGTCTCAGACTCCTGGGCTCAAGCAATCCACCCACCTTAGTCTCC
CAAAGTGCTGGGATTACAGGCGTGAGCCACCACACCCA

Sequence C
GGAATTTCACTCTTGTTGCCCAAGTTGGAGTGCAATGGCGCGATCTCAGCTCACTGCAACCTCCGCCTCCCAGGTTCAAACGATTCTCCTGCTTCACTCTCCCCAGTAGCTGG
GATTACAGGCTGCACCACCACACCTGGCTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCC
CACCTCAGCCTCCCAAAGTGCTGGGATTACAAGCATGAGCCACCACTCCCAGGC

Sequence D
GCTTCATCTTTCTCTTCACCGTAAAACAGGAAAGTGTGTGGTGACCAGTATTTTAAGGGAAAGGCACTTACAGAGAATTAAGCATTTGACAAAATTTATTTACAGATATTTGT
CTGTGGACCACTTCCGCACCAGCTGTGCATGAGAGGGCTCATTGCTCTGAATTTGCCTCCTTGTCTGCACCCAGGAGACCGTTTCCCAGATCACGCAAACGCTGCCTTCTCCC
CACACCAGGGCCCTCAGCATGGGAATGACCTTCCAGCGCTGCACGTTTCCAATCCATGCTCTGTTTTTCAGTTCTGGCTCACAGAGGACTGCTGGTTGCAAGCAAACTTGTAT
CTGGGTCTTCA

Sequence E
CCTTAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGAT
ATACAATTTGTAAATATTTTCTCTCATTTTGAAGATTTTCTTTTCACTTTCTTGATAATGTCCTTTGTGTATTTTTTGATAATGTCCTTTGATACACAAAAGTTTTTAAGTTT
GATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCAT

Sequence F
TGTTTGTTTGTTTGTTTTGTTTCATTTTGTTTTTGAGACAGAGTCTTGTTCTGTCGCCCAGTGTAGAGTGCAGTGGCATAATCTCGGCTCACCGTAACCTCCGCCTCCCGGGT
TCAAGCAACTCTGCCTGCCTCAGCCTCCCAAGGAGCTGGGATTATAGACGCCCACCACCATGCCTGGTTAATTTTTGTAGTTTTTTTTAGTAGAGATGGGGTTTTGCCATTTT
GGCCAGGCTGGTCTTGAACTCCTGACCTCAGGTGATCTGCCCACCCTGGCCTCTCAAAGTGCTGGGATTACAGGTGTGAGCTGCCACACTCGGCCACAACAAATTTTTGCACC
AGTTGCTCACA

Sequence G
TCCTTTGATACACAAAAGTTTTTAAGTTTGATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCATTCATTTTGTGTCCTATGTAGGAATCTATTGCCAAATTCAAGGT
GATAAAGATTTACCCCTATGTTTCCTTCTAAGAGTTTTATTGTTTTAGCCCTGATATTTAGCTAAACTTAATTGATTTATTAAGTTTAATTTTCCTATGTGGTATGAAGTCAT
TTATCTTCTTTAGTTCAGGATCCAAGTGAAAGGGGCATCTTCTATCTGGGACATGCCATTCTCATGACAGAGGAAAAAGACAAAAAACTGACACATACAATGACTTTAAAACT
TCACTCA

Sequence H
GGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCTCCTGCCTCAGC
CTTCCAAGTAGCTGGGTTTACAGATGCCCACCACCATGCCTGGCTGGTTTTTGTATTTTTAGTAGACACGGGGTTTTACCATGTTGGCCGGGCTGGTCTGGAACTCCTAACCT
TAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGATATA
CAATTTGTAAA

3. On the basis of your alignment results, answer the followingquestions, referring to the sequences by their letter codes (Athrough H):

a.What is the correct order of overlapping contigs?
b.What is the length, measured in number of nucleotides, of eachsequence overlap between contigs?
c.What is the total size of the chromosome segment that youassembled?
d.Did you find any contigs that do not overlap with any of theothers? Explain.
4. Run a nucleotideânucleotide BLAST search (BLASTn) on any of theoverlapping contigs to determine which chromosome these contigswere taken from, and report your answer.
segment is, and what chromosome it came from. here's theassignment. I just need someone to interpret how I should go aboutdoing this.

viridianox52

BIL 150 Lecture Notes - Lecture 25: Transposable Element, Noncoding Dna, Stomach Cancer

Document Summary

Get access

Related Documents

BIL 150 Lecture Notes - Lecture 30: Centromere, Telomere, Tandem Repeat

BIL 150 Chapter Notes - Chapter 1: Reductionism, Cell Theory, Photosynthesis

BIL 150 Lecture Notes - Lecture 20: Molecular Cloning, Reverse Transcriptase, Dna Microarray

Related Questions