CAS BI 105 Lecture Notes - Lecture 11: Primase, Helicase, Tyrosine

24 views3 pages

raspberryserval680

30 Apr 2018

School

Boston University

Department

Biology

Course

CAS BI 105

Professor

Elizabeth Ann Stanford

For unlimited access to Class Notes, a Class+ subscription is required.

DNA REPLICATION:

Start with the DNA Strand in a eukaryotic cell: CTAGGGATTACCATAGGATACAGA

1. Where in the cell is this strand found?

Nucleus

Let’s say this is a gene, and during replication it is changed to: CTAGGGATTACCAAAGGATACAGA.

2. What type of mutation is this?

Missense

3. Will it cause a change in the protein product produced? Why/why not? (Hint: you may want to come

back to this question after finishing question 16).

Yes.

DNA Strand: CTAGGGATTACCATAGGATACAGA

Assume this strand is a template strand being used in DNA replication.

4. What would be the sequence of the new strand being made?

GAUCCCUAAUGGUAUCCUAUGUCU

5. How many of the enzymes involved in DNA replication can you name? What are their roles?

Helicase, RNA Polymerase, DNA Polymerase, Primase, Topiomerase

6. If you are going through DNA replication, how many DNA strands did you start with, and how many

do you end with?

7. When does DNA replication occur (what phase of the cell cycle)?

The S Phase

TRANSCRIPTION:

DNA Strand: CTAGGGATTACCATAGGATACAGA

This is a gene. Before it is a promoter region with the sequence CCCGTATGGATAA. A mutation is

acquired in this promoter region so that it has changed to CCCGTAG.

8. What do you think will happen to the gene as a result?

A) No change to the gene

B) It will never be translated

C) Translation is unaffected but it will not be replicated during DNA replication.

This gene is going to go through transcription.

9. What enzyme is required?

RNA Polymerase

10. What will the resulting molecule be called?

The mRNA Transcript

11. Transcribe this DNA strand here: GAUCCCUAAUGGUAUCCUAUGUCU

12. Where in the cell does transcription take place?

find more resources at oneclass.com

Unlock document

This preview shows page 1 of the document.
Unlock all 3 pages and 3 million more documents.

Already have an account? Log in

Document Summary

Why/why not? (hint: you may want to come back to this question after finishing question 16). Before it is a promoter region with the sequence cccgtatggataa. Take the molecule you ended up with after transcription and write it here: Now let"s use epigenetics to control the making of this gene. The epigenetic mechanisms we studied were: methylation, acetylation, alternative splicing, differing lengths of the cap and tail, sirna, microrna, protein activation. The process we explored in the first 3 pages can be summarized as this: Apply each of the epigenetic mechanisms to the right place in this process. For each epigenetic mechanism, label it as: the protein product is more likely to be made, there will be less protein product made or protein production will be delayed, protein production will be prevented. We discussed some of these epigenetic mechanisms within the context of biotechnology.

Related Questions

Question 1.1. (TCO 8) Which enzyme is neededfor elongation of the RNA molecule during transcription? (Points :2)

RNase
RNA gyrase
RNA helicase
RNA ligase
RNA polymerase

Question 2.2. (TCO 8) Which enzyme is requiredfor HIV to reproduce? (Points : 2)

DNA polymerase
Reversetranscriptase
RNA polymerase
tRNA
Ribosomes

Question 3.3. (TCO 8) Animal viruses thatcontain DNA, including herpesviruses, are generally replicated in_____. (Points : 2)

the cytoplasm
the nucleus
the small intestine ofthe animal
the nasal passages
cytokinesis

Question 4.4. (TCO 8) How many nucleotides docodons have? (Points : 2)

Four
Three
Five
Two
One

Question 5.5. (TCO 8) Operators in prokaryotesare similar to _____ in eukaryotes. (Points : 2)

activators
transcriptionfactors
regulatory genes
enhancers
promoters

Question 6.6. (TCO 8) Eukaryotic repressorproteins bind to _____ to inhibit _____. (Points : 2)

silencers;transcription
operons;transcription
enhancers; DNAreplication
regulators; operons
operators;translation

Question 7.7. (TCO 8) Operons encode _____that block the binding of RNA polymerase. (Points : 2)

promoters
DNA polymerase
regulatory genes
repressors
RNA polymerase

Question 8.8. (TCO 9) There are a number ofrecombinant DNA drugs available on the market today. Not every drugwill make it to the market, though, because problems may occur.Which of the following is an example of a problem that couldprevent a drug from being marketed? (Points : 2)

Production of a humanprotein that is unable to function properly
Formation of a bacteriumthat cannot synthesize the product
A bacterium with DNA thatis resistant to restriction enzymes
Formation of a productthat is not sensitive to proteolytic enzymes
Formation ofmutants

Question 9.9. (TCO 9) Which of the followingwas the first FDA-approved recombinant DNA pharmaceutical? (Points: 2)

Humulin
HGH
SCID
CF
RFLP

Question 10.10. (TCO 9) Which of the followingis an example of a transgenic organism? (Points : 2)

An organism carrying agene that was acquired by artificial means
The first organism inwhich a particular mutation has appeared
An organism carryinggenes from two different parents
A cloned organismcarrying two different alleles
An organism that gestatedin an artificial womb

Question 11.11. (TCO 8) Explain how a mutationin the DNA sequence results in a change to a protein sequence.(Points : 10)

champagnegiraffe407

5. Alpha amanitin is a drug that binds RNA polymerase andprevents it from functioning in the cell (this is the compound thatis found in poison mushrooms). The reason people die when theyconsume alpha amanitin is:

a) Alpha amanitin prevents gene expression from occurring in thecell

b) DNA replication is directly inhibited by alpha amantin

c) Alpha amanitin binds tightly to the messenger RNAs that aremade in the cell, preventing translation

d) Alpha amanitin binds to nuclear pores preventing thetransport of messenger RNA into the cytoplasm

6. In order for transcriptional initiation to begin in E. colithe following elements are needed:

a) an origin and RNA polymerase

b) initiator protein and a promoter

c) the sigma subunit of RNA polymerase and an RNA template

d) RNA polymerase and a promoter

e) helicase and primase

Questions 7 and 8. You are studying two species of closelyrelated snakes, one species lives in sandy desert area and has paletan skin and the species lives in a volcanic rock area and has darkbrown skin. You a sequence the DNA from each type of snake anddiscover a gene encoding a protein that transports pigment into theskin cells. The pigment transporter protein is responsible for skincolor. When you analyze the DNA coding sequence of the pigmenttransporter from each snake you find these two DNA sequences (hashmarks have been added to indicate the reading frame):

pale tan snake: GCG/TTG/GAC/TGC/ACC (DNA template strand)CGC/AAC/CTG/ACG/TGG (complementary strand) dark brown snake:ACG/TTG/GAC/TGC/ACC (DNA template strand) TGC/AAC/CTG/ACG/TGG(complementary strand)

7. From these sequences you conclude:

a) that the amino acid sequence of the pigment transporters forthe two proteins are almost identical

b) that the amino acid sequence of the pigment transporters forthe two proteins are very dissimilar

c) that the amino acid sequence of the pigment transporters forthe two proteins are identical

8. Since the skin color is different in each snake, you concludefrom the sequence data above that:

a) the genetic code in the skin cells in each of these snakes isdifferent

b) the DNA sequence encoding the entire gene for pigmenttransporters in these two snakes is different

c) that one of the codons in the gene for the pigmenttransporter in these two snakes is different

9. You are analyzing eukaryotic cells that have been exposed tothe radioactive uracil. In most cells the radioactive uracil isinitially localized in the nucleus and then moves from the nucleusto the cytoplasm. However, you observe that in some cells theradioactive molecules stay in the nucleus and never arrive in thecytoplasm. This is most likely a defect in:

a) the transcription of the DNA

b) the processing of the mRNA

c) the translation of the RNA

d) the labeling of the RNA

e) the replication of the DNA

10. Which of the following is true of both eukaryotic andbacterial transcription? (select all that are true)
a) Transcription factors must bind the promoter before RNApolymerase initiates transcription

b) Messenger RNAs must be spliced before translation begins inorder to produce the appropriate gene product

c) During transcription only one DNA strand is used as atemplate to make the messenger RNA

d) Termination of transcription occurs when the RNA polymerasetranscribes a hairpin structure in the RNA followed by a string ofU

erinporpoise384

1. In Humans, many types of cancers have been linked to?

A. Duplications
B. Inversions
C. translocations
D. deletions
E all of these

2. 5- bromoouracil is mutagenic because it is a(n)

a. base-modifying agent
b. base analog
c. intercalating agent
d. alkylating agent.

3.Ultraviolet radiation creates __________ in DNA

A. 5-methyl cytosine residues
B. breakages
C point mutations
D. mutational hot spots
E thymine dimers

4. The telomeres of chromosomes is composed of

A. heterochromatin
b. nucleosome
c. histone
d. achromatic

5. In eukaryotes, a replicon is

a. the distance between the origin of replication and thetermination of replication
b. a single chromosome
c. the entire genome
d. one DNA strand of a single chromosome

6. In a nonreciprocal interchomosomal translocation, a segment of achromosome is

a. exchanged with an identical segment on a differentchromosome
b. exchanged with an identical segment on a sister chromatid
c. transferred to a different chromosome without a reciprocalexchange of genetic material
d. transferred to a new location on the same chromosome without areciprocal exchange of genetic material

7. Somatic mutations are always.

a. spontaneous
b. carcinogenic
c. heritable
d. lethal
e. none of these

8. A woman with an XO genotype is

a. aneuploid
b. euploid
c. diploid
d. poluploid

9. Spontaneous mutations may occur as a result of

a. all of these
b. errors in DNA replication
c. transposition
d. none of these
e. normal cell biochemistry

10. In the semi conservative model of DNA replication, progenydouble helices consist of

a. one parental DNA strand and one new strand
b. one parental DNA strand and one new RNA strand
c. two new RNA strands
d. two parental DNA strands
e. two new DNA strands

11. A mutation in a gene may alter a cellâs

a. phenotype
b. genotype and phenotype
c. genotype

12. During replication, the direction of synthesis of new DNA fromthe leading strand is

a. both 5â to 3â and 3â to 5â
b. none of these
c. 3â to 5â
d. from left to right only
e. 5â to 3â only

13. A mutation that results in a switch from a purine-pyramidingbase pair to a pyramiding-purine base pair is a _________mutation.

a. neutral
b. transition
c. missense
d. transversion
e. nonsense

14. A trisomic human cell would contain how many chromosomes?

a. 45
b. 46,
c. 47.
d. 48

15. In a strand of DNA, a _____________ bond connects the phosphategroup of one nucleotide to the sugar of the adjacentnucleotide

a. hydrogen
b. ester
c. phosphodiester
d. phosphate
e. disulfide

16. Cri-du-chat syndrome is caused by which type of chromosomalmutation?

a. deletion
b. duplication
c. translocation
d. transversion
e. inversion

17. During replication, the role of DNA primase is to

a. add nucleotide to the growing DNA chain
b. synthesize a short chain for RNA
c. untwist the double helix at the origin of replication
d. relax the super coiling of the double helix
e. synthesize the primo some

18. A(n) ____________ inversion involves the Centro mere

a. chromocentric
b. paracentric
c. epicentric
d. percentric
e. concentric

19. Which of the following substances mutates DNA by intercalatingbetween adjacent base pairs?

a. methyl methane sulfonate
b. all of these
c. nitrous acid
d. 2-amino urine
e. acridine orange

20. A molecule of RNA is always

a. double stranded
b. helical
c. nonparallel
d. all of these
e. none of these

21. Mutagenesis of cells using radiation or a chemicalintercalating agent could be used to create __________ mutations ina region of DNA.

a. random
b. both random and site-specific
c. site-specific

22. In Griffithsâs tranformation experiments, the mice died whenthey were injected with

a. living, no virulent bacteria
b. living, virulent bacteria
c. heat-killed, no virulent bacteria
d. living, nonvirulent bacteria
e. both B and D

23. A monoploid human cells

a. shows only the excessive phenotype of all these genes
b. would be functionally impaired
c. is normal
d. would not survive

24. Gametes containing an abnormal number of chromosomes may occuras a result of

a. paracentric inversion
b. reciprocal translocation
c. disjunction of chromosomes
d. unequal crossing over

25. DNA may be altered as a result of _____________ events thatoccur normally in cells

a. depurination
b. deamination
c. depyrimidation
d. all of the above
e. none of the above

26. Which enzyme prevents DNA from tangling up as the replicationfork migrates during replication?

a. DNA polymerase I
b. DNA helicase
c. topoisonmerase
d. DNA polymerase III
e. DNA gyrase

27. Which of the following enzymes play an important role in DNAreplication?

a. DNA helicase
b. DNA ligase
c. DNA primase
d. all of them
e. DNA polymerase III

28. A mutation gene sustains a mutation that restores the originalphenotype, This is a

a. frame shift mutation
b. transversion
c. reversion
d. transition
e. forward mutation

29. A dicentric chromosome has two

a. telomeres
b. mutations
c. arms
d. centromeres

30. Which type of chromosomal mutation cannot revert to thewild-type state

a. duplication
b. deletion
c. translocation
d. both A and C
e. all of them

31. Translation of histone mRNAs occurs during which phase of theeukaryotic cell cycle?

a. M
b. G1
c. G2
d. S
e. all of these

32. After removal of the RNA primers, Okazaki fragments are joinedthrough a reaction that involves which enzyme?

a. RNA polymerase
b. DNA helicase
c. DNA polymerase
d. DNA primase
e. DNA ligase

33. Which of the following is required for the synthesis of DNAduring replication?

a. DNA polymerase
b. magnesium ions
c. all of them
d. template DNA
e. dNTPs

34. Most of the genome of an active cell consists of

a. heterochromatin
b. histochromatin
c. poluchromatin
d. euchromatin

35. In eukaryotes, DNA replication begins,

a. a single origin of replication on each chromosome
b. a single origin of replication on each chromosome
c. multiple origins of replication on each chromosome
d. all of the above
e. none of the above

36. A human cell contains 2 sets of 24 chromosomes is

a. euploid
b. haploid
c. polyploid
d. aneuploid

37. Pseudodominance occurs as a result of which type ofmutation?

a. translocation
b. duppolication
c. all of these
d. point mutation
e. deletion

38. The enzymatic activity of a telomerase is best described asa

a. none of these
b. polymerase
c. ligase
d. reverse transcriptase
e. topoisomerase

39. A Barr body is an example of

a. constitutive heterochromatin
b. facultative heterochromatin
c. facultative euchromatin
d. constitutive euchromatin

40. An addition or deletion of one or two base pairs in a genecauses a ____________ mutation

a. Transition
b. frameshift
c. nonsense
d. transversion
e. neutral

41. A heterozygous chromosomal inversion can be detected

a. by cytogenetic observation of loops in chromosomes
b. through genetic studies indicating a decrease in the frequencyof recombination between genes
c. by observing a decrease in the number of viable progenyfollowing genetic crosses
d. all of the above

42. The mutagen 5-bromouracil is an analog of which base?

a. adenine
b. threonine
c. thymine
d. cystosine
e. uracil

43. A mutation that changes a codon from one that represents anamino acid to one that signals a chain termination is a______________ mutation.

a. neutral
b. missense
c. frame shift
d. nonsense

44. A chromosomal mutation that results in an increase in theamount of DNA is a(n)

a. duplication
b. inversion
c. deletion
d. both A and C
e. all of the above

45. Prior to replication, the DNA double helix must be untwisted bywhich type of enzyme?

a. topoisomerase
b. ligase
c. polymerase
d. helicase
e. primase

46. In his transformation experiments, Griffiths used cultures ofwhich bacterium?

a. Sacchromyces cerevisiae
b. Escherichia coli
c. Streptococcus pneumoniae.
d. Bacillus cereus
e. Eneterococcus faecalis

47. A mutation changes a codon from a UCG to a UAG. This is a____________ mutation?

a. point
b. nonsense
c. silent
d. both A and B
e. all of the above

48. In eukaryotes, DNA replication

a. is initiated at several sites on chromosomes
b. occurs bidirectional
c. is semidiscontinuous
d. all of the above
e. none of the above

49. Which of the following bacteria are used in the Amestest?

a. Pseudomonas aeruginosa
b. Escherichia coli
c. Vibrio cholera
d. Salmonella typhimurium
e. Rickettsia rickettsii

50. Which of the following changes represents a missensemutation?

a. UGA (stop) to UAG (stop)
b. AAA (lysine) to AGA (arginine)
c. UUU (phenylalanine) to UAA (stop)
d. AUG (methionine) to UGA (stop)
e. AAA (lysine) to AAG (lysine)

CAS BI 105 Lecture Notes - Lecture 11: Primase, Helicase, Tyrosine

Document Summary

Get access

Related Documents

CAS BI 105 Lecture Notes - Lecture 14: Spindle Apparatus, Cellular Respiration, Telomere

CAS BI 105 Lecture Notes - Lecture 19: Frameshift Mutation, Nonsense Mutation, Silent Mutation

CAS BI 105 Lecture Notes - Lecture 10: Acetyl Group, Nonsense Mutation, Silent Mutation

Related Questions