Biology 1002B Lecture 12: BIo 1002B Lecture 12

16 views8 pages

ultramarinecrab393

12 Mar 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Has information for proteins and control of protein! (regulate and stuff) The ribosomal rna is catalytic (rna is smart and does the job and makes peptide bonds), proteins are structural in rna. The gene for dna polymerase codes for its own replication. Organelles have bacterial gene machinery (ribosomes and shit) Polymerase really only touches dna at around -10 and -35. Tata are in eukaryotic but prokaryotes don"t have classic tata box. Green and black arrows are regions that matter to rna. Purple arrows indicate regions that destroy or dramatically affect the promoter. Rna polymerases are just like dna polymerases in the sense that they only add new bases onto the 3" end. At end of the gene whole things disassembles and falls apart. The promoter determines wher polymerase binds and transcription begins!! Genes can be coded on either strand of double helix and you can"t tell which it is without more information.

Related Questions

A biochemist was studying the structure of a normal (native) and mutant form of a globular protein. Both proteins could be crystallized, but the mutant protein had a different tertiary structure than the native protein.

1. The biochemist determined that an important structural region of the native protein was encoded for by the following mRNA sequence:

(5â) GCCAAAAGUACAGCAUGGCAA (3â)

Using the table of the genetic code (lecture 12, slide 10), list from the N-terminus to C-terminus the corresponding amino acid sequence for the native protein:

The same region of the mutated protein was encoded by the following mRNA sequence:

(5â) GCCAACAGUACAGCAGGGCAA (3â)

List from the N-terminus to C-terminus the corresponding amino acid sequence for the mutant protein:

2. Propose a plausible explanation for why the mutations led to a change in the tertiary structure of the native protein.

emeraldwalrus12

1. What is an organic molecule?

2.Name three hydrocarbons and be able to draw their structural formulas.

3. What is an isomer? List and describe the three types (structural, geometric, and enantiomers).

4. Be able to recognize and describe the properties of these functional groups: aldehyde, ketone, hydroxyl, sulfhydryl, carboxyl, amino, and phosphate groups.

5. What is a monosaccharide? Give two examples of these molecules and their functions.

6. Describe these chemical reactions: dehydration synthesis (condensation reaction) and hydrolysis (rehydration).

7. What is a disaccharide? List two and give their functions.

8. What is a polysaccharide? List two storage forms and two structural forms. How are they formed and what is their specific function?

9. How do the pancreatic hormones insulin and glucagon regulate blood sugar levels?

10. What is molting and why is it necessary in certain animals?

11. What four molecules are bonded together to form a triglyceride or fat? Why are fats nonpolar? What are some functions of fats as well as other lipids such as oils and waxes?

12. How do saturated and unsaturated fats differ? Discuss bonding patterns and possible sources of these fats. Which type is healthier for you? Why?

13. Why do animals store most of their excess glucose as fats or oils rather than as glycogen or protein? Give two reasons.

14. What are phospholipids? Identify parts of the phospholipid bilayer that are hydrophobic or hydrophilic? What important cell structure do these molecules help create?

15. Describe the structure of a steroid. How is cholesterol used in beneficial ways in your body?

16. What are LDLs and HDLs? Which is considered good or bad cholesterol? What condition could result from high blood pressure?

17. What are four ways to either reduce high blood cholesterol or maintain a safe level?

18. What is the composition of an amino acid? Why would they be considered nonpolar, polar, acidic, or basic?

19. Define dipeptides and polypeptides.

20. Describe the primary structure of a protein. What type of bonding creates it?

21. What is the secondary structure of a protein? Name two types of secondary structure and indicate what type of bonding holds them together. List three fibrous proteins.

22. What is the tertiary structure of a protein? What types of bonds or chemical interactions allow a protein to maintain this structure? List three globular proteins.

23. What is the quaternary structure of a protein? Describe a hemoglobin molecule.

24. What are the subunits of nucleic acids and what is their composition? How are these subunits bonded together? What is DNS's basic shape?

25. List three differences between DNA and RNA.

Query Sequence: ATATCAGAGCACACTCACGCGGACAGAATGCCGAG

1. Identify the gene from which the query sequence originates (Name of gene)

2. Provide the full protein sequence encoded by the gene (single letter amino acid abbreviation form).

3. Are different splice variants known for this gene? How many?

4. What human disease has been connected to this gene?

5. Calculate molecular weight (kiloDalton [kD]) and the calculated pI of the protein (the pH where the protein carries no net electrical charge).

6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a reference to a web page.

7. Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue).

8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.

*9. Generate an protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homologue).

*10. Generate a secondary structure prediction for one identified protein.

Biology 1002B Lecture 12: BIo 1002B Lecture 12

Document Summary

Get access

Related Documents

Biology 1002B Lecture Notes - Lecture 12: Ribosomal Rna, Riboswitch, Chlamydomonas

Biology 1002B Lecture Notes - Lecture 12: Start Codon, Release Factor, Stem-Loop

Biology 1002B Lecture Notes - Lecture 12: Ribosomal Rna, Ribozyme, Ribose

Related Questions