Log in
HomeClass Notes1,200,000CA670,000

Biology 1002B Lecture Notes - Lecture 8: Intron, Transfer Rna, Dicer

18 views12 pages
blushbee712
20 Jan 2020
School
Western University
Department
Biology
Course
Biology 1002B
Professor
Tom Haffie Denis Maxwell

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Intron: a non-protein coding sequence that interrupts the protein-coding sequence in a eukaryotic gene. Introns are removed by splicing in the processing of pre-mrna to mrna: not all eukaryotic genes contain introns. Exon: an amino acid coding sequence present in pre-mrna that is retained in a spliced mrna that is translated to produce a polypeptide. Precursor mrna (pre-mrna): the primary transcript of a eukaryotic protein-coding gene, which is processed to form mrna. 5" cap: in eukaryotes, a guanine-containing nucleotide attached in a reverse orientation to the 5 end of pre-mrna and retained in the mrna produced from it. The 5" cap on mrna is the site where ribosomes attach to initiate translation: modifications added after transcription; post-transcriptional modification, no signal in the dna for the 5" cap. Spliceosome: a complex formed between the pre-mrna and small ribonucleoprotein particles, in which mrna splicing takes place.

Get access

Grade+
$40 USD/m
Billed monthly
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
10 Verified Answers
Class+
$30 USD/m
Billed monthly
Class+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
7 Verified Answers

Related Documents

Biology 1002B Chapter Notes - Chapter 12+13: Precursor Mrna, Polyadenylation, Intron
erinimpala672
Biology 1002B Chapter Notes - Chapter 13: Organelle, Nuclear Pore, Ribosome
silverwolf688
Biology 1002B
Final Exam
Study Guide
Biology 1002B Study Guide - Final Guide: Tata Box, Precursor Mrna, Stop Codon
harlequinlizard209

Related Questions

QUESTION 1

Which of the following statements regarding splicing is FALSE?

A) The length of introns determines the efficiency of splicing.

B) Many human neurological disorders are caused by splicing errors and/or mutations in splicing factors.

C) Splicing requires the action of a variety of snRNAs that direct the transesterification reactions.

D) Splicing is dictated by sequence features in pre-mRNA transcripts

QUESTION 2

Which of the following mRNA processing factors does NOT associate with the CTD of RNA polymerase II?

A) splicing factors

B) polyadenylation factors

C) miRNAs/siRNAs

D) capping proteins

QUESTION 3

Which of the following statements about mRNA stability is FALSE?

A) Deadenylation-independent mRNA decay is exclusively in the 5' to 3' direction.

B) The most common pathway of mRNA decay is deadenylation-dependent.

C) Yeast mRNA decay occurs primarily in the 5' to 3' direction, while 3' to 5' decay is more common in mammalian cells.

D) Decapping enzymes are required for all pathways of mRNA decay.

QUESTION 4

You obtain the sequence of a gene containing 10 exons, 9 introns, and a 3′ UTR containing a polyadenylation consensus sequence. The fifth exon also contains a polyadenylation site. To test whether both polyadenylation sites are used, you isolate mRNA and find a longer transcript from muscle tissue and a shorter transcript from all other tissues. Which of the following is the most likely mechanism underlying these alternative transcripts?

A) The fifth exon is spliced out of the mature mRNA transcript in muscle cells.

B) Muscle cells have less effective polyadenylation than other tissues.

C) An alternative CPSF protein is expressed in muscle cells with lower affinity for the polyadenylation sequence in exon 5.

D) The mRNA in muscle cells is edited to eliminate the polyadenylation sequence in exon 5.

1) Describe important steps needed to express the gene coding for protein x if protein x were isolated from eukaryotic organism.

2) You are intrested in detecting the expression of the gene coding for protein X in R.palustris in the presence and absance of specific antibiotic.Name and breifly describe the technique that you would use. Justfy your reasoning.

3) you are intrested in silencing expression of wild-type gene that codes for protein x without disrupting or modifying the actual gene and its regulatory regions. What assay would you use and why?

a) Using the template strand sequence below from a EUKARYOTE, transcribe it to mRNA, properly end modify it, and then translate it into protein. Do not worry about splicing, this is one of the rare genes with no introns. Use the single letter amino acid abbreviations when writing the protein sequence.

5’- GTTAACGCTTCAGGAGACACTTCCCGATAAGCACCATGGTGGCCCG -3’

1 2

b) If there is a transition mutation at the arrow labeled 1 and a transversion to a G at the arrow labeled 2, what will be the new mRNA and protein sequence become? Is the protein likely to be functional?