Log in
HomeClass Notes1,200,000CA670,000

MBG 3080 Lecture Notes - Lecture 7: Problem Set, Cytosine, Thymine

40 views4 pages
amethysttoad124
4 Dec 2017
School
University of Guelph
Department
Molecular Biology and Genetics
Course
MBG 3080
Professor
Steven Seah

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Problem set: dna repair and mutagenesis: (a) the diagram below shows the various lesions found on a double stranded dna. Propose mechanisms of how these lesions can arise in dna. (b) name and describe all the possible dna repair systems that can be used to repair the lesions in the dna below. You should also indicate which strand of dna will be repaired in each system and why. Mutant e. coli muts - merodiploid: e. coli muts - [muts+: mutant e. coli dam - merodiploid: e. coli dam - [dam+, mutant e. coli uvrb - merodiploid:e. coli uvrb - [uvrb+] Recall that repressors bind to the operator sequence within the promoter region of a gene. An outbreak shows the slippery slope between benign and deadly. Excerpt from the atlantic 24th may 2017 by sarah zhang. Elizabethkingia anophelis a largely unremarkable microbe named after the pioneering microbiologist elizabeth o.

Get access

Grade+
$40 USD/m
Billed monthly
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
10 Verified Answers
Class+
$30 USD/m
Billed monthly
Class+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
7 Verified Answers

Related Documents

MBG 3080 Lecture Notes - Lecture 6: Methyltransferase, Deamination, Uracil
rubylocust666
MBG 3080
Final Exam
Study Guide
MBG 3080 Study Guide - Midterm Guide: Restriction Enzyme, Catabolite Activator Protein, Cytosine
ceruleansnail417
MBG 3080 Lecture Notes - Lecture 1: Deoxycytidine Monophosphate, Nucleic Acid Double Helix, Thymidine Monophosphate
rubylocust666

Related Questions

1. In addition to identifying the genetic material, the experiments of Avery, MacLeod, and McCarty with different strains of Streptococcus pneumoniae demonstrated that
DNA is a double helix.
DNA may be taken up by bacterial cells and be active.
DNA is present in bacteriophage T2.
eukaryotic cells may be genetically transformed.
DNA binds to the cell wall of the bacterium.
2. In order to show that DNA in cell extracts is responsible for genetic transformation in Streptococcus pneumoniae, important corroborating evidence should indicate that _______ also destroy transforming activity.
temperatures high enough to kill cells
enzymes that hydrolyze proteins
enzymes that hydrolyze DNA
enzymes that hydrolyze polysaccharides
enzymes that hydrolyze RNA
3. Based on what you have learned about the experiments conducted by Griffith and Avery and colleagues with bacteria, which of the following would result in transformation of living R cells?
Pure RNA from S cells
Cell-membrane extracts from S cells
A mixture of pure RNA and protein from S cells
Cell-free extracts from S cells
Pure protein from S cells
4. A-T base pairs in a DNA double helix
form three hydrogen bonds with each other.
are more heat-stable than G-C base pairs.
are of a substantially different length than G-C base pairs.
are not accessible to DNA binding proteins.
are chemically distinct from G-C base pairs.
5. If 23 percent of the bases in a sample of double-stranded DNA are adenine, what percentage of the bases are uracil?
27
50
0
73
23
6. The uniform diameter of the DNA structure provides evidence for
antiparallel DNA strands.
a right-handed helix.
a double-stranded helix.
3′ end phosphorylation.
purine–pyrimidine pairing.
7. If a sequence of one strand of DNA is 5′-TGACTATC-3′, what is the complementary strand?
5′-ACTGATAG-3′
3′-TGACTATC-5′
3′-ACTGATAG-5′
3′-ACTGATAG-3′
5′-TGACTATC-3′
8. What structural aspect of the DNA facilitates dissociation of the two DNA strands for replication?
3′ end phosphorylation
Purine–pyrimidine pairing
Antiparallel DNA strands
Covalent bonds between sugars and phosphate groups
Hydrogen bonding between paired bases
9. If the Meselson–Stahl density gradient experiment had resulted in two bands of DNA molecules after only one round of replication, one containing only 15N and the second only 14N, this result would have indicated that replication was
unidirectional.
dispersive.
conservative.
bidirectional.

semiconservative.
10. The nucleoside analogue acyclovir, which is used to treat herpes simplex virus (HSV) infections, lacks a 3′ hydroxyl group (–OH). Predict what will happen if the host cell DNA polymerase incorporates a molecule of acyclovir into an elongating strand of HSV DNA.
The replication complex will no longer bind to origins of replication.
The DNA polymerase will only incorporate acyclovir molecules.
Acyclovir will bind single-strand binding proteins.
DNA polymerase will not be able to link a successive nucleotide.
Acyclovir will block the activity of the DNA helicase.
11. Which of the following does not demonstrate the stability of the DNA double helix?
Single-strand binding proteins are required to keep the strands apart.
Paired bases form hydrogen bonds.
High temperatures are required to denature it.
DNA synthesis requires energy.
DNA helicases require ATP.
12. What effect would a primase inhibitor have on DNA replication?
DNA polymerase would not be able to add bases to the DNA.
Primase would be blocked from joining the DNA replication complex.
Primase would not be able to provide primers for DNA polymerases.
DNA polymerase would not be able to use DNA as a template.
There would be no effect on DNA replication.
13. To replicate their DNA in a timely manner, most eukaryotic chromosomes
normally have uncoiled DNA.
have multiple origins of replication.
contain linear molecules of single-stranded DNA.
have two replication forks that move in the same direction.
are composed entirely of DNA.
14. Which statement about DNA replication is false?
Okazaki fragments are synthesized as parts of the leading strand.
Error rates for DNA replication are reduced by proofreading of the DNA polymerase.
The sliding clamp increases the rate of DNA synthesis.
Replication forks represent areas of active DNA synthesis on the chromosomes.
Ligases and polymerases function in the vicinity of replication forks.
15. In many eukaryotes, there are repetitive sequences called telomeres at the ends of chromosomes. After successive rounds of DNA replication, the _______ strand becomes shorter. In some cells, an enzyme called _______ repairs the shortened strand.
leading; telomerase
lagging; telomerase
lagging; DNA polymerase I
leading; DNA polymerase I
leading; replicase
16. A researcher studies normal human fibroblast cells. They can be maintained in culture but die off after about 30 cell generations. Unexpectedly, a colony of cells continues to survive and divide past 30 generations. Which scenario is most likely true for these cells?
DNA polymerase is constantly active.
Primase is able to extend the telomeres.
The mismatch repair system is extra efficient.
The telomerase gene is being expressed.
The cells do not need the ends of their chromosomes.
17. If DNA polymerase III introduces an incorrect nucleotide, what is the first corrective action made by the DNA repair system?
The replication complex excises the incorrect nucleotide.
The excision repair proteins remove the incorrect nucleotide.
The mismatch repair system scans for base-pairing mismatches.
There is no correction, because nucleotide errors by DNA polymerases are not repaired.
DNA ligase connects the correct nucleotide.
18. Choose the correct order of the following four events in the excision repair of DNA:
(1) Base-paired DNA is made complementary to the template.
(2) Damaged bases are recognized.
(3) DNA ligase seals the new strand to existing DNA.
(4) Part of a single strand is excised.
1, 2, 3, 4
2, 1, 3, 4
3, 4, 2, 1
2, 4, 1, 3
4, 2, 3, 1
19. Six complete cycles of PCR should result in a _______-fold increase in the amount of DNA.
64
32
12
128
6
20. When double-stranded DNA is heated to temperatures above 90°C, it denatures. Denaturation is a process that
breaks covalent bonds.
hydrolyzes DNA.
separates double-stranded DNA into two single strands.
causes new hydrogen bonds to form.
irreversibly destroys the double helical structure.

Which of the following did Erwin Chargaff observe?

A)

Base composition changes as the organism ages.

B)

Base composition of DNA does not vary from one species toanother.

C)

In all species the number of adenines equals the number ofguanines.

D)

In all species A + T = G + C.

E)

DNAs isolated from different tissues of the same species havethe same base composition.

The melting temperature (Tm) of a DNA duplex is:

A)

the temperature at which double-stranded nucleic acids degradeinto free nucleotides.

B)

the temperature at which double-stranded DNA is toosingle-stranded to ever renature back to double strands.

C)

the temperature at which double-stranded DNA is completelymelted.

D)

the temperature at which double-stranded DNA has become 50%single-stranded.

E)

the temperature at which double-stranded DNA begins to melt.

Given your knowledge and the descriptions of each of thesemethods, which of the following does NOT rely on the ability ofnucleic acids to hybridize with each other?

A)

Southern blotting for the detection of specific DNA fragmentsthat have been separated by gel electrophoresis.

B)

Colony blot hybridization to identify a specific sequence from acollection of sequences that have been inserted into bacteria.

C)

Northern blotting for the detection of specific RNA fragmentsthat have been separated by gel electrophoresis.

D)

A DNA oligonucleotide microarray incubated with probes made fromcDNA.

E)

Western blotting for the detection of specific proteins thathave been separated by gel electrophoresis.

Which of the following is a possible reason why DNA uses thymineinstead of uracil?

A)

Cytidine is deaminated to uracil so it would be difficult forany repair mechanism to differentiate between uracil that belongsin the sequence and uracil that resulted from deamination.

B)

Adenine is deaminated to uracil so it would be difficult for anyrepair mechanism to differentiate between uracil that belongs inthe sequence and uracil that resulted from deamination.

C)

When uracil is bound to a deoxyribose it will become morereactive, forming covalent bonds with other bases.

D)

None of the above.

Which of the following is an enzyme used in cloning to breakcovalent bonds?

A)

DNA ligase

B)

Restriction endonuclease

C)

Reverse transcriptase

D)

DNA polymerase I

E)

Alkaline phosphatase

Which of the following could you use to remove the 5' phosphatesafter cleavage of a plasmid with a single type of restrictionenzyme to ensure that the plasmid would not simply fuse backtogether upon addition of ligase?

A)

Reverse transcriptase

B)

Alkaline phosphatase

C)

DNA ligase

D)

DNA polymerase I

E)

Restriction endonuclease

Which of the following would you use to create a cDNA librarythat you would not use for a genomic library?

A)

Alkaline phosphatase

B)

Reverse transcriptase

C)

Restriction endonuclease

D)

DNA ligase

E)

DNA polymerase I

A plasmid vector typically has which of the followingfeatures?

A)

An origin of replication

B)

A selectable marker to ensure that the only bacteria growingcontain the intact or recombinant vector.

C)

Unique restriction sites for insertion of DNA.

D)

Small size to facilitate entry into the cell and biochemicalmanipulation of the DNA.

E)

All of the above are features of plasmid vectors.

Which of the following is FALSE of genomic or cDNAlibraries?

A)

Genes represented in cDNA libraries include control sequencesthat direct transcription.

B)

cDNA libraries contain cDNAs made from mRNA.

C)

Genomic libraries contain fragments of genomic DNA that aregenerated by partial digests with restriction enzymes.

D)

Genomic libraries usually contain large fragments and are likelyto be constructed in YAC or BAC vectors.

E)

cDNA libraries contain sequences from expressed genes only.

Which of the following is NOT a typical component of apolymerase chain reaction (PCR)?

A)

dNTPs

B)

DNA containing the sequences to be amplified

C)

DNA ligase to connect the fragments together

D)

Primers complementary to each end of the sequence to beamplified

E)

Heat stable Taq polymerase

How can a fusion protein be formed?

A)

Site-directed mutagenesis where a fragment is replaced with asynthetic sequence containing the altered DNA sequence.

B)

Two proteins can recombine in the bacterial cell to form a newhybrid protein.

C)

Portions of two different genes are ligated together to create anew hybrid gene. When expressed the gene product is a fusion of thetwo gene products.

D)

Using oligonucleotide-directed mutagenesis to introduce specificmutations that cause the expressed protein to fuse to otherproteins.

E)

A portion of the gene can be removed to form a shorter gene andtherefore a shorter protein.

Why is green fluorescent protein (GFP) so useful in visualizingfusion proteins in eukaryotes?

A)

The GFP protein recognizes and binds to fusion proteins allowingthe location of the fusion protein to be determined.

B)

The reaction is only dependent on the presence of GFP and oneother cofactor.

C)

It is easily cloned and expressed in bacterial cells.

D)

The presence of just a few molecules of GFP fusion proteins canbe sufficient for observing the proteins microscopically allowingthe study of its location and movements in the cell.

E)

It is derived from fire flies, which are easy to cultivate inthe lab.

You wish to determine the cellular location of a protein butunfortunately it is not particularly antigenic (can t develop astrong antibody response). How could you solve this problem?

A)

Create a fusion protein with an epitope tag that can bevisualized by incubation with fluorescently tagged antibody to theepitope.

B)

Create a fusion with green fluorescent protein (GFP).

C)

Express the protein as a fusion with biotin. The addition of GFPwill cause fluorescence.

D)

A and B might work.

E)

A, B, and C might work.

F)

None of the above will work.

A positive result for the yeast two-hybrid analysis means thefollowing:

A)

The proteins that you are studying can be made into fusionproteins, but do NOT interact with each other within the nucleus ofyeast.

B)

A fusion protein containing the Gal4p activation domain, hasbound to RNA polymerase resulting increase transcription ofnumerous genes, including the reporter gene, and formation ofcolonies.

C)

Two fusion proteins, one containing the Gal4p binding sitedomain and one containing the Gal4p activation domain, haveinteracted through their Gal4p domains resulting in transcriptionof the reporter gene.

D)

Two fusion proteins interact with each other and because of theGal4p binding site domain and the Gal4p activation domain containedin each fusion protein, the reporter genes are activated and thecells die resulting in no colonies.

E)

The colonies growing are expressing the two fusion proteins, butthe two proteins have not interacted with each other.

Which of the following is the approximate size of the humangenome?

A)

3 Gm

B)

300 Kb

C)

3 Mb

D)

3 Gb

E)

3 Mm

Which of the following is correct about the structure orlocation of genes?

Question 22 options:

A)

Prokaryotic genes typically possess their own regulatorysequences that only control expression of a single gene.

B)

Eukaryotic genes often encode introns that are spliced outbefore translation.

C)

Eukaryotic genes are mostly located at the telomeres and thecentromeres of chromosomes.

D)

Eukaryotic genes are typically arranged in operons.

E)

Prokaryotic genes often encode exons that are spliced out beforetranslation

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose

Glucose

Lac expression?

No

Yes

Yes

Yes

Yes

No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5’AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3’

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?