CMMB 461 Lecture Notes - Lecture 27: Dna-Binding Domain, Ura3, His3

75 views2 pages

rosefrog223

29 Dec 2018

School

University of Calgary

Department

Cellular, Molecular and Microbial Biology

Course

CMMB 461

Professor

Gordon Chua

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Make proteins, but thrones in cells need interaction with other proteins. This system is involved in binary protein interactions (2 proteins interacting with each other) You have a transcription factor (2 components/domains: dna binding domain, activation domain (if transcription factor)), separate both domains using gal4. Have a reporter gene that is regulated by gal4, then you have gal4 dna binding domain with orfx. The other hybrid protein is activation domain of gal4 which is fused to another protein. Need to express both hybrid proteins in yeast cell. Gal4 dna binding domain will bind to gal4 binding sites. If gal4 binds to binding site with orfx, dna binding domain is not sufficient to bring in activation domain. If orfx and orfy interact with each other, now gal4 dna binding domain is brought very close to activation domain. When they do that, it reconstitutes a transcriptional activator. If x and y don"t interact, reporter gene doesn"t fire.

Related Questions

I am trying to understand the Y2H screening method. I canunderstand how we can check if two specific proteins interact witheach other. For example, if we want to check whether protein A andprotein B interact, we fuse A with the Activation Domain (AD) of atranscription factor and B with the Binding Domain (BD) of anothertranscription factor. When the two fusion proteins are transfectedinto a yeast cell, the reporter gene is expressed only if the ADand the BD get together and form a complete transcription factorand that happens only if proteins A and B interact with eachother.

However, I have seen claims that Y2H is a high throughputsystem, i.e., it can be used to detect several interactions atonce. But most articles online that attempt to describe it, seemvague to me.

For example, suppose I fuse the "bait" protein to the BD andseveral different cDNA's to the AD and let the yeast grow. Next, Iobserve that the reporter gene is expressed. Doesn't thisobservation only imply that there exists some protein from the cDNAlibrary that interacts with our bait protein? How do we knowexactly which of the target proteins have interacted with the baitand resulted in the expression of the reporter gene?

You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F â GCCAATGTGCTGA

SP-1 â GCTGACAGTTAA

C/EBPa â ACAGTTAATTAGG

It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.

QUESTION 10

If you can drink milk as an adult, it means that you have inherited a mutation in the promoter of your lactase gene (the gene that encodes the enzyme you need to break down lactose). Predict the effect of this mutation:

		The mutation changes the number of domains in the enzyme, which makes it work more efficiently
		The mutation changes the amino acid sequence of the lactase protein
		The mutation increases the number of copies of the lactase gene that will be found in your genome
		The mutation changes whether the lactase sequence is found in an intron or exon
		The mutation affects the expression of the lactase gene

1.2 points

QUESTION 11

A competitive inhibitor is decreasing the activity of an enzyme. Predict the effect of adding more substrate to the reaction.

		The substrate will increase the reaction rate by binding to the allosteric site
		The substrate will increase the reaction rate by competing with the inhibitor for the active site
		The reaction rate will not change unless the inhibitor can be removed
		The enzyme adjusts its shape so that the substrate, but NOT the competitive inhibitor, can bind
		The substrate will bind to the competitive inhibitor and block its ability to bind to the enzyme

1.2 points

QUESTION 12

What determines where in the genome a transcription regulator will bind?

		Transcription regulators bind to the 5' UTR region of a gene
		Regulators bind via complementary base-pairing to certain DNA molecules
		Covalent bonds form between the transcription regulator and the atoms of the DNA backbone
		Every eukaryotic gene has a different transcription regulator that will bind to the 5' end of the gene
		Transcription regulators bind to specific DNA sequences via multiple weak non-covalent interactions

1.2 points

QUESTION 13

What is the basic premise of cell theory?

		DNA -> RNA -> protein
		All cells arise from pre-existing cells
		DNA provides the complete instructions to create a cell
		The identity of a cell is determined through gene expression patterns
		All cells contain the same four basic macromolecules

1.2 points

QUESTION 14

What is the benefit of using BOTH the lac activator and the lac repressor to control gene expression?

		Using both an activator and repressor enables cells to more accurately determine the amount of lactose available in the environment
		Enzymes to digest lactose are only made when energy is low and lactose is available
		The activator can override the inhibition of the lac operon by the repressor
		The repressor can control the enhancer, while the activator can control the promoter
		When neither the lac activator or repressor is present, expression of the lac operon is too high

1.2 points

QUESTION 15

What is the histone code used for?

		Phosphorylation and acetylation of DNA affect its ability to be compacted
		Changes to the sequence of DNA change whether DNA will wrap around histone proteins
		Covalent modifications of histones affect the ability of the transcription initiation complex to form
		Histones provide the codon sequences needed for translation to occur
		The histone code affects which amino acids will get added to a polypeptide

CMMB 461 Lecture Notes - Lecture 27: Dna-Binding Domain, Ura3, His3

Document Summary

Get access

Related Documents

CMMB 461 Lecture Notes - Lecture 21: Dna-Binding Domain, Transcription Preinitiation Complex, Tata Box

CMMB 461 Lecture Notes - Lecture 24: Power Law, Lac Operon, Histidine

CMMB 461 Lecture Notes - Lecture 26: Signal Peptide, Lipid Bilayer, Immunoprecipitation

Related Questions