BIOLOGY 1A03 Lecture Notes - Lecture 14: Dna Replication, Primase, Chromosome
![BIOLOGY 1A03 Full Course Notes](https://new-docs-thumbs.oneclass.com/doc_thumbnails/list_view/2135478-class-notes-ca-mcmaster-biology-1a03-lecture2.jpg)
BIOLOGY 1A03 Full Course Notes
Document Summary
Get access
Related Documents
Related Questions
1. | In addition to identifying the genetic material, the experiments of Avery, MacLeod, and McCarty with different strains of Streptococcus pneumoniae demonstrated that | ||||||||||
|
2. | In order to show that DNA in cell extracts is responsible for genetic transformation in Streptococcus pneumoniae, important corroborating evidence should indicate that _______ also destroy transforming activity. | ||||||||||
|
3. | Based on what you have learned about the experiments conducted by Griffith and Avery and colleagues with bacteria, which of the following would result in transformation of living R cells? | ||||||||||
|
4. | A-T base pairs in a DNA double helix | ||||||||||
|
5. | If 23 percent of the bases in a sample of double-stranded DNA are adenine, what percentage of the bases are uracil? | ||||||||||
|
6. | The uniform diameter of the DNA structure provides evidence for | ||||||||||
|
7. | If a sequence of one strand of DNA is 5â²-TGACTATC-3â², what is the complementary strand? | ||||||||||
|
8. | What structural aspect of the DNA facilitates dissociation of the two DNA strands for replication? | ||||||||||
|
9. | If the MeselsonâStahl density gradient experiment had resulted in two bands of DNA molecules after only one round of replication, one containing only 15N and the second only 14N, this result would have indicated that replication was | ||||||||||
|
10. | The nucleoside analogue acyclovir, which is used to treat herpes simplex virus (HSV) infections, lacks a 3â² hydroxyl group (âOH). Predict what will happen if the host cell DNA polymerase incorporates a molecule of acyclovir into an elongating strand of HSV DNA. | ||||||||||
|
11. | Which of the following does not demonstrate the stability of the DNA double helix? | ||||||||||
|
12. | What effect would a primase inhibitor have on DNA replication? | ||||||||||
|
13. | To replicate their DNA in a timely manner, most eukaryotic chromosomes | ||||||||||
|
14. | Which statement about DNA replication is false? | ||||||||||
|
15. | In many eukaryotes, there are repetitive sequences called telomeres at the ends of chromosomes. After successive rounds of DNA replication, the _______ strand becomes shorter. In some cells, an enzyme called _______ repairs the shortened strand. | ||||||||||
|
16. | A researcher studies normal human fibroblast cells. They can be maintained in culture but die off after about 30 cell generations. Unexpectedly, a colony of cells continues to survive and divide past 30 generations. Which scenario is most likely true for these cells? | ||||||||||
|
17. | If DNA polymerase III introduces an incorrect nucleotide, what is the first corrective action made by the DNA repair system? | ||||||||||
|
18. | Choose the correct order of the following four events in the excision repair of DNA: (1) Base-paired DNA is made complementary to the template. (2) Damaged bases are recognized. (3) DNA ligase seals the new strand to existing DNA. (4) Part of a single strand is excised. | ||||||||||
|
19. | Six complete cycles of PCR should result in a _______-fold increase in the amount of DNA. | ||||||||||
|
20. | When double-stranded DNA is heated to temperatures above 90°C, it denatures. Denaturation is a process that | ||||||||||
|
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
Lactose | Glucose | Lac expression? |
No | Yes | |
Yes | Yes | |
Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?