1
answer
0
watching
322
views
16 Nov 2019
CHEM 151 Fall 2016 Final Exam Review Chapter 8, Chapter 9.1 1. Explain why, RNA, and not DNA, is hydrolyzed under basic pH conditions. Draw a mechanism to explain your reasoning. 2. A strand of DNA has the following sequence: S TCGTTTACGATCCCCATTTCGTACTCGA 3 a) What is the sequence of its complementary strand? b) What is the base sequence of mRNA transcribed from the first strand? 3. Hand-draw out the DNA sequence AGTC and its complement including sugars and phosphate backbone. Show the hydrogen-bonding between the base pairs and label the directionality of each strand 4. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme EcoRI SATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 5. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme BamHI S'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3" 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 6. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme Kpnl and Hind III S'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 7. Describe why a double-stranded DNA with a high G-C content has a higher Tm than a double-stranded DNA with a high A-T content. 8. A Sanger dideoxy sequence analysis was performed on wild type and a mutant gene. The sequencing gels are represented below. From these results
CHEM 151 Fall 2016 Final Exam Review Chapter 8, Chapter 9.1 1. Explain why, RNA, and not DNA, is hydrolyzed under basic pH conditions. Draw a mechanism to explain your reasoning. 2. A strand of DNA has the following sequence: S TCGTTTACGATCCCCATTTCGTACTCGA 3 a) What is the sequence of its complementary strand? b) What is the base sequence of mRNA transcribed from the first strand? 3. Hand-draw out the DNA sequence AGTC and its complement including sugars and phosphate backbone. Show the hydrogen-bonding between the base pairs and label the directionality of each strand 4. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme EcoRI SATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 5. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme BamHI S'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3" 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 6. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme Kpnl and Hind III S'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 7. Describe why a double-stranded DNA with a high G-C content has a higher Tm than a double-stranded DNA with a high A-T content. 8. A Sanger dideoxy sequence analysis was performed on wild type and a mutant gene. The sequencing gels are represented below. From these results
Deanna HettingerLv2
18 Sep 2019