BCH311H1 Lecture Notes - Lecture 1: Uracil, Cytosine, Adenine

1. Unlike DNA, RNA contains

deoxyribose

a double strand

phosphates

uracil

Nucleic acid structure

2. In transcription, uracil will bond with:

thymine

cytosine

adenine

guanine

Transcription

3. The first team of scientist to document the structure of DNA was:

Franklin and Wilkins

Watson and Crick

Pauling and Chargoff

None of the above

DNA structure

4. Organelles that synthesize protein are:

lysosomes

ribosomes

endoplasmic reticulum

golgi bodies

5. Most of the time in a cell's life, it's DNA is in the form of:

Chromatin

Chromatids

Replicated chromosomes

Spindle fibers

6. Uracil is a nitrogen base that pairs with adenine. Using this information, one could conclude that uracil is a:

Purine

Pyrimidine

Neither a purine or pyrimidine

Not enough information

7. a nucleotide does not consist of a:

polymerase

5-carbon sugar

phosphate group

nitrogen base

8. The genetic code in DNA of an individual depends on the sequence (order) of:

nucleotides

purines only

phosphates

sugars

9. Before a cell divides, it must duplicate its DNA in a process known as:

translation

transformation

transcription

replication

10. The basic unit (building block) of a protein is a (an):

carbohydrate

amino acid

lipid

hydrogen bond

11. Unlike DNA, RNA contains:

deoxyribose

a double strand

phosphates

uracil

12. The structure of DNA was first documented in:

1945

1953

1956

1962

13. In DNA replication, the new molecules produced are:

of unequal length

both assembled in the same direction

built with purines as the backbone

assembled in opposite directions

DNA replication

14. The "backbone" of DNA is composed of:

ribose and phosphates

deoxyribose and phosphates

ribose and uracil

deoxyribose and thymine

DNA structure

15. RNA differs from DNA in which of the following ways?

RNA is single-stranded

RNA contains ribose

RNA does not contain thymine

All of the above

DNA structure

16. Which of the following is NOT required for the transcription process itself?

RNA polymerase

DNA

uracil-containing nucleotides

ribosomes

1. Use the following definitions and phrases to describe to which molecules of life and their subunits it belongs:

a. Energy-storing molecule, typically water soluble - b. Subunits are called monosaccharides – c. Used to speed chemical reactions - d. Subunits are joined to each other with peptide bonds - e. Most prevalent molecule in cell membranes - f. Some of them function as hormones - g. Used for storing, transmitting, and executing genetic information - h. Subunits are nucleotides

2. Weak hydrogen bonds between water molecules are responsible for the many properties of water. Acidity is expressed as pH. Buffers stabilize pH. a. What characteristics of water molecule makes it polar? Provide two examples why this property is important in microbiology. b. What is the role of buffers in living organisms, including microbes? c. What must be added to pure water to decrease OH- and/or H+ concentration, respectively

3. Carbohydrates serve as storage molecules and structural material. Lipids are hydrophobic molecules; phospholipids are main component of cell membranes. Protein has a complex structure based on identity and sequence of amino acids. Nucleic acids (DNA and RNA) are genetic station of storage information and for synthesis of proteins. ATP serve as the main energy source in the living cell. a. Name the subunits (building blocks) of carbs, simple lipids, proteins, and nucleic acids b. What level of protein structure is described as an alpha helix? c. If DNA is placed in boiling water, what and how the molecule would change?

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5’AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3’

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?