Unit 2: Genetics Assignment
In this assignment you will convert a DNA sequence into proteins through several steps. If you have no idea where to begin I recommend that you watch the âHow to read the Genetic Codeâ and âProtein Synthesisâ videos
Here is the DNA sequence:
TACCACGCCAAGCGAAGCGGGATT
Part 1: Transcribe the sequence into mRNA and separate the mRNA into codons. Name the enzyme responsible and the start and stop codons used.
Part 2: Give the tRNA anticodons that match the mRNA.
Part 3: Translate the mRNA into amino acids.
Part 4: Give an example of how a mutation to this sequence could cause a silent mutation.
Hereâs an example that you can complete:
Normal DNA = CAC Mutated DNA = CAG
Normal mRNA = Mutated mRNA=
Normal amino acid = Mutated amino acid=
*What do you notice happened above?
*What does this tell you about the effect of a silent mutation?
Part 5: Give an example of how a mutation to this sequence could cause a missense mutation.
Hereâs an example that you can complete:
Normal DNA = CAC Mutated DNA = GAC
Normal mRNA = Mutated mRNA=
Normal amino acid = Mutated amino acid=
*What do you notice happened above?
*What does this tell you about the effect of a missense mutation?
Part 6: Besides mutations how else do bacteria acquire new genes? Define each of these in your own words:
*transformation
*transduction
*conjugation