ITM 207 Lecture 2: The Case of the Druid Dracula--PCR Lab
9 May 2018
School
Department
Course
Professor
AP Biology Name:
Unit 7—Genetic Technology
The Case of the Druid Dracula
Peggy Brickman
Department of Plant Biology
University of Georgia
Part I—DNA Structure and PCR
In the northernmost corner of the Isle of Anglesey in Wales in a village called Llanfairpwll, the
windswept beaches and ancient Druid ruins provided a surreal backdrop for the murder of 90-
year-old Mabel Leyshon. Her murder was not only brutal—her heart had been hacked out—but
also creepy; it appeared as if the killer had collected Mabel’s blood in a small kitchen saucepan
that had lip marks on the rim indicating the contents had been tasted. The murder showed other
signs of the occult; a candlestick and a pair of crossed pokers had been arranged near the body.
Further investigation indicated that this was no supernatural villain at work. The murderer had
worn tennis shoes which had left distinctive footprint under the glass door that had been
shattered with a piece of broken garden slate in order to gain entrance to the victim’s home.
Inside the house, a windowsill had bloodstains on it. With luck, the evidence recovery unit
hoped to use it to find the killer.
In this investigation, your job is to understand the process of PCR and then to use agarose gel
electrophoresis to examine the PCR products from this case.
Questions
1. DNA is composed of nucleotides that are joined together by covalent bonds between
which two portions of each nucleotide?
a. Between deoxyribose and a phosphate group
b. Between two deoxyribose groups
c. Between the nitrogen-containing rings
d. Between a phosphate group and the nitrogen-containing ring.
e. Between the phosphate groups of both nucleotides.
2. In the hydrogen bonds between nitrogen-containing bases ____________.
a. A always pairs with C
b. A always pairs with G
c. C always pairs with T
d. G always pairs with T
e. G always pair with C
3. From which evidence mentioned in the above paragraph might we find DNA for DNA
analysis?
Differences in Amelogenin
Found on the X chromosome, the amelogenin gene (AMELX) encodes a protein that is critical
for the formation of the enamel on teeth. Individuals with deletions in this gene can have
problems forming the normal thickness of enamel on their teeth, and/or problems in the
mineralization of the enamel, so that their enamel may remain softer than normal. A duplicate
version of the amelogenin gene can be found on the Y chromosome in primates (AMELY), but
there are significant differences between these two amelogenins. One of those differences is
found in intron I of AMELX, which is missing 6 nucleotides found in AMELY. PCR can be
performed using primers flanking this region to amplify DNA sequences from both the AMELX
and AMELY. PCR products generated from AMELX will be 106 base-pairs in length; PCR
products from AMELY will be 112 base pairs in length.
Questions
1. DNA differences can be used to identify people. For example, the differences in
AMELX and AMELY can be used to tell if a blood stain, such as the one found on the
windowsill inside Mable Lyshon’s house, was left by a man or a woman. This stretch of
nucleotides shows one strand of the DNA double helix for the amelogenin gene; what is
the sequence of the other complementary strand?
5’CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG 3’
a. 3’ACTGTTAGATTTCCCTTTTTAGGTCTAGGTCCGTCGGCCTTATTTCCGAGGAATAA 5’
b. 3’GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC 5’
c. 5’GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC 3’
d. 3’CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG 5’
e. 5’CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG 3’
2. To assist the investigators with the crime, you will need to perform Polymerase Chain
Reaction (PCR) to create copies of this gene so the sizes can be compared to determine if
the blood was from a man or woman. During PCR it will be necessary to break the
hydrogen bonds of the base pairs. Where are those hydrogen bonds normally found?
a. Between two nitrogen-containing bases in a single strand of DNA.
b. Between the phosphate and sugar of the same nucleotide.
c. Between the sugar of one nucleotide and the phosphate of a different
nucleotide.
d. Between one nitrogen-containing base on a single strand of DNA and another
nitrogen-containing base on the complementary strand of DNA.
e. Between one phosphate on a single strand of DNA and a sugar on the
complementary strand of DNA.
3. PCR creates copies of DNA using the exact same mechanism used by your cells to copy
their own DNA (replication). Place the steps listed below in the order in which they
occur during replication:
A) two strands, one new and one original template, wind together to form the double
helix.
B) short stretch of primer (~20 nucleotides exactly complementary to the gene that is
going to be copied) is made.
C) separation of the double helix from two parental DNA strands.
D) use of parental DNA as a template so that nucleotides are covalently bonded together
to form a new chain that is complementary to the bases on the original template.
a. A, B, C, D
b. B, C, A, D
c. D, B, C, A
d. C, B, D, A
Document Summary
In the northernmost corner of the isle of anglesey in wales in a village called llanfairpwll, the windswept beaches and ancient druid ruins provided a surreal backdrop for the murder of 90- year-old mabel leyshon. The murder showed other signs of the occult; a candlestick and a pair of crossed pokers had been arranged near the body. Further investigation indicated that this was no supernatural villain at work. The murderer had worn tennis shoes which had left distinctive footprint under the glass door that had been shattered with a piece of broken garden slate in order to gain entrance to the victim"s home. Inside the house, a windowsill had bloodstains on it. With luck, the evidence recovery unit hoped to use it to find the killer. In this investigation, your job is to understand the process of pcr and then to use agarose gel electrophoresis to examine the pcr products from this case.
