FOR10002 Lecture Notes - Lecture 7: Forensic Science, Feces, Nitrogenous Base

81 views7 pages
Department
Course
Professor
FORENSIC SCIENCE - FOR10002
WEEK 7
DNA
DNA is the sequence of base pairs and the code that determines the protein that is produced, and
therefore determines your biology.!
DNA profiling is arguably the most useful technique used in forensic science. It was developed in
the mid 1980s and rapidly found its way into courts of law. It is more correctly referred to as
profiling or typing, rather than fingerprinting. It should not be used as the sole piece of evidence in
a court of law.!
Overview!
DNA profiling is highly specific to an individual, but less so than DNA fingerprinting (which is not
practical).!
It is extremely robust!
It is applicable to a wide range of biological sources from an individual!
It is independent of those sources!
It requires very little sample.!
Sources of DNA!
GOOD
Semen!
Blood (white cells)!
Hair (with follicles on the roots)!
Vaginal fluid (containing cells)!
Nasal secretions (containing cells)!
OK
Sweat!
Hair shafts!
Skin (cells)!
Urine (contains cells, but not many)!
Faeces (contains cells, but not many)!
BAD
Blood (red cells)!
DNA Profiling!
DNA profiling is now:!
Cheap!
Rapid!
Accurate (but subject to contamination and interpretation error)!
Able to be run in batch mode!
Database-searchable!
Supported by a wide range of experts!
DNA!
DNA is a very large molecule (but still very small)!
DNA contains instructions for producing proteins!
find more resources at oneclass.com
find more resources at oneclass.com
Unlock document

This preview shows pages 1-2 of the document.
Unlock all 7 pages and 3 million more documents.

Already have an account? Log in
Proteins then perform biochemical processes, determining (almost) everything, from the
functions of the cell to your physical appearance!
Whether or not the above biochemical processes work as intended is aected by environmental
factors!
If the function of a given gene can be observed to occur, then the gene is said to be
“expressed”!
Not all genes are expressed!
Structure of DNA!
DNA is a polymer of nucleotides.!
Each nucleotide is composed of!
-Nitrogenous base!
-Pentose sugar (deoxyribose)!
-Phosphate group!
STRUCTURE OF NUCLEOTIDES
The$nucleotide$in DNA consists of a sugar (deoxyribose), one of
four bases (cytosine (C), thymine (T), adenine (A), guanine (G)), and
a phosphate. Cytosine and thymine are pyrimidine bases, while
adenine and guanine are purine bases. The sugar and the base
together are called a nucleoside.!
NITROGENOUS BASES
Two types!
Purines:!
-Adenine (A)!
-Guanine (G)!
Pyrimidines!
-Cytosine (C)!
-Thymine (T)!
STR!
STR’s are short tandem repeats in a strand of DNA base pairs (eg. AGGCTATCTATCTATCGAAT)
3x4=12!
DNA & RNA!
DNA is the template for producing RNA, which in turn is the template for producing proteins.
Proteins then perform most of the cell functions, and therefore determine the phenotype.!
DNA Definitions!
Genotype: the complete genetic makeup of an individual, determined at conception!
Phenotype: the observance physical result of expression of an individual’s genes!
Gene: a portion of DNA that determines a given characteristics — e.g.. eye colour/blood type!
Allele: An individual form of a gene — eg. Type A allele Vs Type O!
‘Junk’ DNA: portions of DNA that do not code for anything!
Exon: the type of a gene that codes for protein!
Intron: the art of a gene that does not code for a protein!
How Does DNA Work?!
DNA is the template for producing RNA, which in turn is the template for producing proteins.
Proteins then perform most of the functions of the cell, and therefore determine the phenotype. !
A single DNA chain contains many dierent genes. The DNA segments between genes are
referred to as intergenic DNA. Only around 10% of human DNA codes for protein!
DNA is organised into chromosomes. !
find more resources at oneclass.com
find more resources at oneclass.com
Unlock document

This preview shows pages 1-2 of the document.
Unlock all 7 pages and 3 million more documents.

Already have an account? Log in

Document Summary

Dna is the sequence of base pairs and the code that determines the protein that is produced, and therefore determines your biology. Dna pro ling is arguably the most useful technique used in forensic science. It was developed in the mid 1980s and rapidly found its way into courts of law. It is more correctly referred to as pro ling or typing, rather than ngerprinting. It should not be used as the sole piece of evidence in a court of law. Good: semen, blood (white cells, hair (with follicles on the roots, vaginal uid (containing cells, nasal secretions (containing cells) Ok: sweat, hair shafts, skin (cells, urine (contains cells, but not many, faeces (contains cells, but not many) Dna pro ling is now: cheap, rapid, accurate (but subject to contamination and interpretation error, able to be run in batch mode, database-searchable, supported by a wide range of experts.

Get access

Grade+
$40 USD/m
Billed monthly
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
10 Verified Answers
Class+
$30 USD/m
Billed monthly
Class+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
7 Verified Answers

Related Documents